pGFH-9
(Plasmid
#39538)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 39538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRP9
-
SpeciesH. sapiens (human)
-
Entrez GeneSRP9 (a.k.a. ALURBP)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco R1 (not destroyed)
- 3′ cloning site Bam H1 (not destroyed)
- 5′ sequencing primer CGAGAAGCGCGATCACATGG
- 3′ sequencing primer TCAGGGGGAGGTGTGGGAGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene's sequencing results identified several nucleotide mismatches from bp# 1621-1629 when compared to the full plasmid sequence provided by the depositing laboratory. These differences are not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFH-9 was a gift from Katharina Strub (Addgene plasmid # 39538 ; http://n2t.net/addgene:39538 ; RRID:Addgene_39538) -
For your References section:
Residues in SRP9/14 essential for elongation arrest activity of the signal recognition particle define a positively charged functional domain on one side of the protein. Mary C, Scherrer A, Huck L, Lakkaraju AK, Thomas Y, Johnson AE, Strub K. RNA. 2010 May;16(5):969-79. Epub 2010 Mar 26. 10.1261/rna.2040410 PubMed 20348448