pGFH14A6-12
(Plasmid
#39543)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1P
- Total vector size (bp) 5123
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRP14
-
SpeciesH. sapiens (human)
-
Mutationdeleted amino acids 101-113
-
GenBank IDX73459.1
-
Entrez GeneSRP14 (a.k.a. ALURBP)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco RI (not destroyed)
- 3′ cloning site Xma I (not destroyed)
- 5′ sequencing primer GCGATCACATGGTCCTGCTG
- 3′ sequencing primer GTTCAGGGGGAGGTGTGGGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFH14A6-12 was a gift from Katharina Strub (Addgene plasmid # 39543 ; http://n2t.net/addgene:39543 ; RRID:Addgene_39543) -
For your References section:
SRP keeps polypeptides translocation-competent by slowing translation to match limiting ER-targeting sites. Lakkaraju AK, Mary C, Scherrer A, Johnson AE, Strub K. Cell. 2008 May 2;133(3):440-51. 10.1016/j.cell.2008.02.049 PubMed 18455985