-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40257-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40257-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
-
Backbone manufacturerInvitrogen/Dr. Paulmurugan Ramasamy
- Backbone size w/o insert (bp) 6107
- Total vector size (bp) 8282
-
Modifications to backboneIn pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSFP-CR
-
SpeciesSynthetic; Ciona intestinalis
-
Insert Size (bp)2175
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer BGH Reverse
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe amplified the voltage sensitive domain from Ciona intestinalis by PCR from Addgene plasmid 16255. The plasmid pcDNA3.1/Puro-CAG was a kind donation by Dr. Paulmurugan Ramasamy (Stanford University).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Voltage sensor domain of Ci-VSP fused to a pair of fluorescent proteins consisting of a Clover GFP and mRuby2 RFP.
DNA (Catalog # 40257-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40257-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-VSFP-CR was a gift from Michael Lin (Addgene plasmid # 40257 ; http://n2t.net/addgene:40257 ; RRID:Addgene_40257) -
For your References section:
Improving FRET dynamic range with bright green and red fluorescent proteins. Lam AJ, St-Pierre F, Gong Y, Marshall JD, Cranfill PJ, Baird MA, McKeown MR, Wiedenmann J, Davidson MW, Schnitzer MJ, Tsien RY, Lin MZ. Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. 10.1038/nmeth.2171 PubMed 22961245