-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS313
-
Backbone manufacturerATCC, Number: 77142
- Backbone size w/o insert (bp) 4967
- Total vector size (bp) 9860
-
Vector typeYeast Expression
-
Selectable markersLEU2, URA3, HIS3 ; MET15/17
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLEU2
-
Alt nameYCL018W
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2116
-
GenBank IDNM_001178665.1
-
Entrez GeneLEU2 (a.k.a. YCL018W)
- Promoter endogenous LEU2
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AACAAAGGAACCTAGAGGCC
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameURA3
-
Alt nameYEL021W
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1096
-
GenBank IDNM_001178836
-
Entrez GeneURA3 (a.k.a. YEL021W)
- Promoter endogenous URA3
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GATTCGGTAATCTCCGAAC
- 3′ sequencing primer GGCCTCTAGGTTCCTTTGTT (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameMET15/17
-
Alt nameYLR303W
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1620
-
GenBank IDNM_001182191
-
Entrez GeneMET17 (a.k.a. YLR303W, MET15, MET25)
- Promoter endogenous MET15/17
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATCGCATGCGCCATCCTCATGAAAACTGT
- 3′ sequencing primer TGCTTCCGGCTCCTATGTTGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygenes were amplified by PCR from plasmids pRS425 (LEU2, ATCC Number:77106), p426GPD (URA3, ATCC Number:87361) and pRS411 (MET15/17, ATCC Number:87474)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHLUM was a gift from Markus Ralser (Addgene plasmid # 40276 ; http://n2t.net/addgene:40276 ; RRID:Addgene_40276) -
For your References section:
A prototrophic deletion mutant collection for yeast metabolomics and systems biology. Mulleder M, Capuano F, Pir P, Christen S, Sauer U, Oliver SG, Ralser M. Nat Biotechnol. 2012 Dec 7;30(12):1176-8. doi: 10.1038/nbt.2442. 10.1038/nbt.2442 PubMed 23222782