Skip to main content

pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic)
(Plasmid #40325)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40325 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6018
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MCP-1 promoter (mutated)
  • Alt name
    macrophage chemoattractant protein-1 promoter (mutated)
  • Alt name
    CCL2 promoter (mutated)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1200
  • Mutation
    contains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site. Sequence has two base changes from the wild-type MCP-1 promoter around the -150 bp position (see note below).
  • GenBank ID
    U12470
  • Entrez Gene
    Ccl2 (a.k.a. HC11, JE, MCAF, MCP-1, MCP1, SMC-CF, Scya2, Sigje)
  • Promoter MCP-1
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (unknown if destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene.

A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers:

5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start)

5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start)

The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers:

5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′

5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′

and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic.

For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site:

5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′

5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets)

The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic) was a gift from Alexander Dent (Addgene plasmid # 40325 ; http://n2t.net/addgene:40325 ; RRID:Addgene_40325)
  • For your References section:

    BCL-6 regulates chemokine gene transcription in macrophages. Toney LM, Cattoretti G, Graf JA, Merghoub T, Pandolfi PP, Dalla-Favera R, Ye BH, Dent AL. Nat Immunol. 2000 Sep;1(3):214-20. 10.1038/79749 PubMed 10973278