-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSicoR PGK Puro
-
Backbone manufactureraddgene
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructions18 hrs at 250 rpm
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWnt reporter sequences
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat), G. gallus (chicken), B. taurus (bovine), X. laevis (frog), D. rerio (zebrafish)
- Promoter Wnt promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ccagggatttcagtcgatgt
- 3′ sequencing primer aatctgacgcaggcagttct (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by7 Tcf/Lef binding sequences are from M50 plasmid. Xiaojun (Lance) Lian cloned this dual Wnt reporter.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This lentiviral Wnt reporter has 7 repeats of Tcf/Lef binding sites, which was cloned by Xiaojun (Lance) Lian.
Methods for Plasmid construction, lentiviral production and infection of hESCs:
The 7 TCF/LEF binding site sequences were obtained by direct PCR of plasmid M50 (Addgene plasmid 12456) and the GreenFire (GF) sequences were obtained by direct PCR of the pGreenFire1-mCMV Plasmid (System Bioscience TR010PA-1). These two sequences were cloned into pSicoR PGK puro (Addgene plasmid 11586) digested by Xba I (NEB) and Xho I (NEB). The constructed Wnt reporter plasmid was named 7TGFP and verified by sequencing. This 7TGFP vector was cotransfected with the helper plasmids psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259) into HEK-293TN cells (System Biosciences) for virus production. Virus-containing medium was collected at 48 and 72 hours after transfection and used for infection of hESCs in the presence of 6μg/mL polybrene (Sigma). Transduced cells were cultured in mTeSR1 on Matrigel for three days and then clonally isolated in mTeSR1 with 1 μg/mL puromycin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXL010-Wnt dual (GFP-Fire) reporter was a gift from Sean Palecek (Addgene plasmid # 40588 ; http://n2t.net/addgene:40588 ; RRID:Addgene_40588) -
For your References section:
Modulation of Wnt/beta-catenin signaling in human embryonic stem cells using a 3-D microwell array. Azarin SM, Lian X, Larson EA, Popelka HM, de Pablo JJ, Palecek SP. Biomaterials. 2012 Mar;33(7):2041-9. Epub 2011 Dec 15. 10.1016/j.biomaterials.2011.11.070 PubMed 22177620