pLKO.1-sh-mSlug-4
(Plasmid
#40648)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 puro (Addgene plasmid 8453)
-
Backbone manufacturerWeinberg lab
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesh-mSlug-4
-
Alt nameSlug
-
Alt nameshRNA against mouse Slug
-
gRNA/shRNA sequenceGCAGACCCACTCTGATGTAAA
-
SpeciesM. musculus (mouse)
-
GenBank IDRMM3981-99015342 (Open Biosystems); NM_011415
-
Entrez GeneSnai2 (a.k.a. Slug, Slugh, Snail2)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Reference
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-sh-mSlug-4 was a gift from Bob Weinberg (Addgene plasmid # 40648 ; http://n2t.net/addgene:40648 ; RRID:Addgene_40648) -
For your References section:
Slug and Sox9 cooperatively determine the mammary stem cell state. Guo W, Keckesova Z, Donaher JL, Shibue T, Tischler V, Reinhardt F, Itzkovitz S, Noske A, Zurrer-Hardi U, Bell G, Tam WL, Mani SA, van Oudenaarden A, Weinberg RA. Cell. 2012 Mar 2;148(5):1015-28. 10.1016/j.cell.2012.02.008 PubMed 22385965