Skip to main content

phage-cmv-cfp-24xpp7
(Plasmid #40652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40652 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE-CMV
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Note it is possible that the 24x PP7 repeats may recombine even in Stbl3 cells. If this occurs, try growing the plasmid at 30C instead.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CFP-24xPP7
  • Alt name
    24x PP7 primer-binding site (PBS)
  • Species
    Synthetic
  • Insert Size (bp)
    2180
  • Promoter CMV
  • Tag / Fusion Protein
    • CFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer WPRE-R (5'-CATAGCGTAAAAGGAGCAACA-3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication.

The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:

taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phage-cmv-cfp-24xpp7 was a gift from Robert Singer (Addgene plasmid # 40652 ; http://n2t.net/addgene:40652 ; RRID:Addgene_40652)
  • For your References section:

    Fluorescence fluctuation spectroscopy enables quantitative imaging of single mRNAs in living cells. Wu B, Chao JA, Singer RH. Biophys J. 2012 Jun 20;102(12):2936-44. Epub 2012 Jun 19. 10.1016/j.bpj.2012.05.017 PubMed 22735544