-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHAGE-CMV
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsNote it is possible that the 24x PP7 repeats may recombine even in Stbl3 cells. If this occurs, try growing the plasmid at 30C instead.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCFP-24xPP7
-
Alt name24x PP7 primer-binding site (PBS)
-
SpeciesSynthetic
-
Insert Size (bp)2180
- Promoter CMV
-
Tag
/ Fusion Protein
- CFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer WPRE-R (5'-CATAGCGTAAAAGGAGCAACA-3') (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication.
The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:
taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phage-cmv-cfp-24xpp7 was a gift from Robert Singer (Addgene plasmid # 40652 ; http://n2t.net/addgene:40652 ; RRID:Addgene_40652) -
For your References section:
Fluorescence fluctuation spectroscopy enables quantitative imaging of single mRNAs in living cells. Wu B, Chao JA, Singer RH. Biophys J. 2012 Jun 20;102(12):2936-44. Epub 2012 Jun 19. 10.1016/j.bpj.2012.05.017 PubMed 22735544