Skip to main content

PBCAG-eGFP
(Plasmid #40973)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40973 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGFP
  • Backbone size w/o insert (bp) 5551
  • Total vector size (bp) 6336
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PiggyBac transposon 3' terminal repeats
  • Species
    Synthetic
  • Insert Size (bp)
    430

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GTTATTGTCTCATGAGCGGATAC
  • 3′ sequencing primer No
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PiggyBac 5' terminal repeats
  • Species
    Synthetic
  • Insert Size (bp)
    369

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer No
  • 3′ sequencing primer CCCCCTGCTGTCCATTCCTTATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PBCAG-eGFP was a gift from Joseph Loturco (Addgene plasmid # 40973 ; http://n2t.net/addgene:40973 ; RRID:Addgene_40973)
  • For your References section:

    A method for stable transgenesis of radial glia lineage in rat neocortex by piggyBac mediated transposition. Chen F, LoTurco J. J Neurosci Methods. 2012 Jun 15;207(2):172-80. Epub 2012 Apr 11. 10.1016/j.jneumeth.2012.03.016 PubMed 22521325