PBCAG-eGFP
(Plasmid #40973)

• Depositing Lab: Joseph Loturco
• Publication: Chen et al J Neurosci Methods. 2012 Jun 15;207(2):172-80. Epub 2012 Apr 11.

Backbone

• Vector backbone: pCAGGFP
• Backbone size w/o insert (bp): 5551
• Total vector size (bp): 6336
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PiggyBac transposon 3' terminal repeats
• Species: Synthetic
• Insert Size (bp): 430

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: GTTATTGTCTCATGAGCGGATAC
• 3′ sequencing primer: No

Gene/Insert 2

• Gene/Insert name: PiggyBac 5' terminal repeats
• Species: Synthetic
• Insert Size (bp): 369

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: No
• 3′ sequencing primer: CCCCCTGCTGTCCATTCCTTATTC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Dr.Mario Capecchi
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry