Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40973)


Item Catalog # Description Quantity Price (USD)
Plasmid 40973 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5551
  • Total vector size (bp) 6336
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PiggyBac transposon 3' terminal repeats
  • Species
  • Insert Size (bp)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GTTATTGTCTCATGAGCGGATAC
  • 3′ sequencing primer No
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PiggyBac 5' terminal repeats
  • Species
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer No
  • 3′ sequencing primer CCCCCTGCTGTCCATTCCTTATTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PBCAG-eGFP was a gift from Joseph Loturco (Addgene plasmid # 40973 ; ; RRID:Addgene_40973)
  • For your References section:

    A method for stable transgenesis of radial glia lineage in rat neocortex by piggyBac mediated transposition. Chen F, LoTurco J. J Neurosci Methods. 2012 Jun 15;207(2):172-80. Epub 2012 Apr 11. 10.1016/j.jneumeth.2012.03.016 PubMed 22521325