-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV-N-Flag-HA-IRES-PURO
- Backbone size (bp) 6500
-
Vector typeMammalian Expression, Retroviral ; Gateway Destination vector
- Promoter LTR-driven expression
-
Selectable markersPuromycin
-
Tags
/ Fusion Proteins
- Flag (N terminal on backbone)
- HA (N terminal on backbone)
- IRES Puro (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer Harper-MSCV (CAGCCCTCACTCCTTCTCTAGG)
- 3′ sequencing primer pCDH-rev (GCATTCCTTTGGCGAGAG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-N-Flag-HA-IRES-PURO was a gift from Wade Harper (Addgene plasmid # 41033 ; http://n2t.net/addgene:41033 ; RRID:Addgene_41033) -
For your References section:
Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732