Skip to main content

MSCV-N-Flag-HA-IRES-PURO
(Plasmid #41033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41033 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCV-N-Flag-HA-IRES-PURO
  • Backbone size (bp) 6500
  • Vector type
    Mammalian Expression, Retroviral ; Gateway Destination vector
  • Promoter LTR-driven expression
  • Selectable markers
    Puromycin
  • Tags / Fusion Proteins
    • Flag (N terminal on backbone)
    • HA (N terminal on backbone)
    • IRES Puro (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer Harper-MSCV (CAGCCCTCACTCCTTCTCTAGG)
  • 3′ sequencing primer pCDH-rev (GCATTCCTTTGGCGAGAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-N-Flag-HA-IRES-PURO was a gift from Wade Harper (Addgene plasmid # 41033 ; http://n2t.net/addgene:41033 ; RRID:Addgene_41033)
  • For your References section:

    Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732