-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEF-Bos
-
Backbone manufacturerMizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
- Backbone size w/o insert (bp) 5685
- Total vector size (bp) 7900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTrif
-
Alt nameTIR domain–containing adapter-inducing IFN
-
Alt nameTICAM-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2200
-
GenBank IDNM_182919.3 NP_891549.1
-
Entrez GeneTICAM1 (a.k.a. IIAE6, MyD88-3, PRVTIRB, TICAM-1, TRIF)
- Promoter EF1a
-
Tags
/ Fusion Proteins
- Flag (C terminal on backbone)
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site Esp3/BamHI (destroyed during cloning)
- 5′ sequencing primer EF-1aF
- 3′ sequencing primer G-CSF-R (GATGGGGAACACTGCTGTTTA) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositing lab generated pEF-Bos TRIF Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. Due to the facts that the fusion site into the FLAG/His is a BamHI site and that TRIF has both an internal BamHI and a BglII site, the depositing lab used an Esp3I site to create an overhang compatible with the 3' BamHI site. XhoI was used for cloning at the 5' end. NotI can be used at the 3' end to excise the tagged CDS. The construct also contains a HIS tag.
Esp3I has the following cutting pattern:
CGTCTCNNNNN
GCAGAGN
In the case of TRIF, the fusion results in a junction that resembles a BglII/BamHI fusion, and is therefore unable to be recut.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-Bos TRIF Flag was a gift from Kate Fitzgerald & Tom Maniatis (Addgene plasmid # 41550 ; http://n2t.net/addgene:41550 ; RRID:Addgene_41550) -
For your References section:
IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock DT, Coyle AJ, Liao SM, Maniatis T. Nat Immunol. 2003 May;4(5):491-6. 10.1038/ni921 PubMed 12692549
Map uploaded by the depositor.