pEF-Bos TRAM Flag
(Plasmid #41551)

• Depositing Labs: Kate Fitzgerald, Doug Golenbock
• Depositing Organization: University of Massachusetts, Worcester
  Located in United States of America
• Publication: Fitzgerald et al J Exp Med. 2003 Oct 6;198(7):1043-55. Epub 2003 Sep 29.
• Citations: 1 Article

Backbone

• Vector backbone: pEF-Bos
• Backbone manufacturer: Mizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
• Backbone size w/o insert (bp): 5685
• Total vector size (bp): 6400
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRAM
• Alt name: Toll-IL-1-resistance (TIR) domain-containing adaptor-inducing IFN-beta (TRIF)-related adaptor molecule
• Alt name: TICAM2
• Alt name: toll-like receptor domain-containing adaptor molecule 2
• Species: H. sapiens (human)
• Insert Size (bp): 700
• GenBank ID: NM_021649.6 NP_067681.1
• Entrez Gene: TICAM2 (a.k.a. MyD88-4, TICAM-2, TIRAP3, TIRP, TRAM)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • Flag (C terminal on backbone)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: EF-1aF
• 3′ sequencing primer: G-CSF-R (GATGGGGAACACTGCTGTTTA)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing lab generated pEF-Bos Tram Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. It was cloned with XhoI at the 5' end and BamHI at the 3' end. NotI can be used at the 3' end to excise the tagged CDS. The construct also contains a HIS tag.

DNA (Catalog # 41551-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 41551-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.