Skip to main content

pEF-Bos TRAM Flag
(Plasmid #41551)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEF-Bos
  • Backbone manufacturer
    Mizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
  • Backbone size w/o insert (bp) 5685
  • Total vector size (bp) 6400
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TRAM
  • Alt name
    Toll-IL-1-resistance (TIR) domain-containing adaptor-inducing IFN-beta (TRIF)-related adaptor molecule
  • Alt name
    TICAM2
  • Alt name
    toll-like receptor domain-containing adaptor molecule 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    700
  • GenBank ID
    NM_021649.6 NP_067681.1
  • Entrez Gene
    TICAM2 (a.k.a. MyD88-4, TICAM-2, TIRAP3, TIRP, TRAM)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • Flag (C terminal on backbone)
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer EF-1aF
  • 3′ sequencing primer G-CSF-R (GATGGGGAACACTGCTGTTTA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositing lab generated pEF-Bos Tram Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. It was cloned with XhoI at the 5' end and BamHI at the 3' end. NotI can be used at the 3' end to excise the tagged CDS. The construct also contains a HIS tag.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF-Bos TRAM Flag was a gift from Kate Fitzgerald & Doug Golenbock (Addgene plasmid # 41551 ; http://n2t.net/addgene:41551 ; RRID:Addgene_41551)
  • For your References section:

    LPS-TLR4 signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF. Fitzgerald KA, Rowe DC, Barnes BJ, Caffrey DR, Visintin A, Latz E, Monks B, Pitha PM, Golenbock DT. J Exp Med. 2003 Oct 6;198(7):1043-55. Epub 2003 Sep 29. 10.1084/jem.20031023 PubMed 14517278