-
PurposeRetroviral expression of human G9a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMSCVhyg
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 10600
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameG9a
-
Alt nameEHMT2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3600
-
Entrez GeneEHMT2 (a.k.a. BAT8, C6orf30, G9A, GAT8, KMT1C, NG36)
-
Tag
/ Fusion Protein
- flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
G9A insert contains N665K relative to reference sequence BC018718.1. Depositor states that this mutation should not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCVhygro-F-G9a was a gift from Kai Ge (Addgene plasmid # 41721 ; http://n2t.net/addgene:41721 ; RRID:Addgene_41721) -
For your References section:
Histone H3K9 methyltransferase G9a represses PPARgamma expression and adipogenesis. Wang L, Xu S, Lee JE, Baldridge A, Grullon S, Peng W, Ge K. EMBO J. 2012 Nov 23. doi: 10.1038/emboj.2012.306. 10.1038/emboj.2012.306 PubMed 23178591