Skip to main content

pMALp2x-CARP-1
(Plasmid #41727)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41727 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMAL-p2x
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6695
  • Total vector size (bp) 7484
  • Vector type
    Bacterial Subcloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    clam ADP-ribosylating protein-1
  • Alt name
    CARP-1
  • Alt name
    NAD+:DNA(guanine-N2)-ADP-D-ribosyltransferase
  • Species
    Meretrix lamarckii
  • Insert Size (bp)
    789
  • Mutation
    deleted 5'-UTR nucleotides 1-64
  • GenBank ID
    AB266110
  • Promoter pMB1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gtaaaacgacggccag
  • 3′ sequencing primer ggtcgtcagactgtcgatgaagcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A CARP-1 coding sequence is inserted in "an opposite direction" to the tac promoter of the vector, due to the toxicity to Escherichia coli. This plasmid is for subcloning,; not for expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMALp2x-CARP-1 was a gift from Koji Okamoto (Addgene plasmid # 41727 ; http://n2t.net/addgene:41727 ; RRID:Addgene_41727)
  • For your References section:

    Purification and molecular cloning of a DNA ADP-ribosylating protein, CARP-1, from the edible clam Meretrix lamarckii. Nakano T, Matsushima-Hibiya Y, Yamamoto M, Enomoto S, Matsumoto Y, Totsuka Y, Watanabe M, Sugimura T, Wakabayashi K. Proc Natl Acad Sci U S A. 2006 Sep 12;103(37):13652-7. Epub 2006 Aug 31. 10.1073/pnas.0606140103 PubMed 16945908