pRP_LmCerulean
(Plasmid
#41839)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRP
- Backbone size (bp) 7911
-
Modifications to backboneLinker-monomeric Cerulean (L-mCerulean) was PCRed and cut with Xho I & Not I. This was cloned into pRP cut with Xho I & Not I.
-
Vector typeMammalian Expression, Retroviral
- Promoter CMV
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- mCerulean (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AAGCAGAGCTCGTTTAGTGAA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP_LmCerulean was a gift from Eicke Latz (Addgene plasmid # 41839 ; http://n2t.net/addgene:41839 ; RRID:Addgene_41839) -
For your References section:
ASC speck formation as a readout for inflammasome activation. Stutz A, Horvath GL, Monks BG, Latz E. Methods Mol Biol. 2013;1040:91-101. doi: 10.1007/978-1-62703-523-1_8. 10.1007/978-1-62703-523-1_8 PubMed 23852599