pRP
(Plasmid
#41841)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA3
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 6577
-
Modifications to backbonePart of the SV40 Promotor (Leaving the SV40 Enhancer) through the Neomycin resistance gene in pCDNA3 was removed by digesting with BstZ17 I & Avr II (filled in to blunt), and self-ligating. This was digested with Not I then partially with Xmn I, and the MoMLV 3’ UTR was PCR cloned in with Not I & Xmn I. This was digested with Nru I & BamH I, and PCRed CMV/MoMLV 5'LTR cut with Nru I & BspE I, and PCRed LNGFR cut with BspE I & BamH I were cloned together. This was digested with BamH I & Not I, and PCRed CMV cut with BamH I & HinD III, and annealed oligonucleotde Polylinker with HinD III & Not I overhangs were ligated together. LNGFR was removed with BspE I & BamH I and replaced with PCRed puromycin resistance cut with Age I & Bgl II.
-
Vector typeMammalian Expression, Retroviral
- Promoter CMV
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AAGCAGAGCTCGTTTAGTGAA
- 3′ sequencing primer CTTGCAAAATGGCGTTACTTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe retroviral insert in this vector was made by PCRing CMV and MoMLV elements from pCLNCX (Naviaux et al. J Virol. 1996 August; 70(8): 5701–5705.) and recloning them into a modified pCDNA3 backbone
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP was a gift from Eicke Latz (Addgene plasmid # 41841 ; http://n2t.net/addgene:41841 ; RRID:Addgene_41841) -
For your References section:
ASC speck formation as a readout for inflammasome activation. Stutz A, Horvath GL, Monks BG, Latz E. Methods Mol Biol. 2013;1040:91-101. doi: 10.1007/978-1-62703-523-1_8. 10.1007/978-1-62703-523-1_8 PubMed 23852599