Skip to main content

pET-Expotin 1
(Plasmid #42047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42047 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5311
  • Total vector size (bp) 8527
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Exportin-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3216
  • GenBank ID
    NP_003391
  • Entrez Gene
    XPO1 (a.k.a. CRM-1, CRM1, emb, exp1)
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Expotin 1 was a gift from Kumiko Ui-Tei (Addgene plasmid # 42047 ; http://n2t.net/addgene:42047 ; RRID:Addgene_42047)
  • For your References section:

    Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. Nishi K, Nishi A, Nagasawa T, Ui-Tei K. RNA. 2013 Jan;19(1):17-35. doi: 10.1261/rna.034769.112. Epub 2012 Nov 13. 10.1261/rna.034769.112 PubMed 23150874