- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepsiCHECK-1
- 
              Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3565
- Total vector size (bp) 6940
- 
              Modifications to backboneThe stop codon of Renilla luciferase was removed, and a SalI restriction site was added by PCR.
- 
              Vector typeMammalian Expression, Luciferase
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameZEB1
- 
                    SpeciesH. sapiens (human)
- 
                    GenBank IDNM_030751.4
- 
                        Entrez GeneZEB1 (a.k.a. AREB6, BZP, DELTAEF1, FECD6, NIL2A, PPCD3, TCF8, ZFHEP, ZFHX1A)
- Promoter SV40
- 
    
        Tag
        / Fusion Protein
    - Renilla luciferase (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAACTACAACGCCTACCT (Common Sequencing Primers)
Resource Information
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLuc-CDS was a gift from Kumiko Ui-Tei (Addgene plasmid # 42100 ; http://n2t.net/addgene:42100 ; RRID:Addgene_42100)
- 
                For your References section: E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing. Mazda M, Nishi K, Naito Y, Ui-Tei K. PLoS One. 2011;6(12):e28688. doi: 10.1371/journal.pone.0028688. Epub 2011 Dec 21. 10.1371/journal.pone.0028688 PubMed 22205962
