Skip to main content

pQE-30-HyPer3
(Plasmid #42132)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42132 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQE-30
  • Backbone size w/o insert (bp) 3425
  • Total vector size (bp) 4859
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HYPER 3
  • Species
    Synthetic
  • Insert Size (bp)
    1434
  • Promoter T5
  • Tag / Fusion Protein
    • 6His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aggagaaattaactatgagagg
  • 3′ sequencing primer ccagatggagttctgaggtc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE-30-HyPer3 was a gift from Vsevolod Belousov (Addgene plasmid # 42132 ; http://n2t.net/addgene:42132 ; RRID:Addgene_42132)
  • For your References section:

    HyPer-3: a genetically encoded H2O2 probe with improved performance for ratiometric and fluorescence lifetime imaging. Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella TW, Grabher C, Schultz C, Lukyanov S, Belousov VV. ACS Chem Biol. 2012 Dec 20. 10.1021/cb300625g PubMed 23256573