-
PurposeGenetically encoded H2O2 probe for ratiometric and fluorescence lifetime imaging
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE-30
- Backbone size w/o insert (bp) 3425
- Total vector size (bp) 4859
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHYPER 3
-
SpeciesSynthetic
-
Insert Size (bp)1434
- Promoter T5
-
Tag
/ Fusion Protein
- 6His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aggagaaattaactatgagagg
- 3′ sequencing primer ccagatggagttctgaggtc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE-30-HyPer3 was a gift from Vsevolod Belousov (Addgene plasmid # 42132 ; http://n2t.net/addgene:42132 ; RRID:Addgene_42132) -
For your References section:
HyPer-3: a genetically encoded H2O2 probe with improved performance for ratiometric and fluorescence lifetime imaging. Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella TW, Grabher C, Schultz C, Lukyanov S, Belousov VV. ACS Chem Biol. 2012 Dec 20. 10.1021/cb300625g PubMed 23256573