pSYN-PACE-001
(Plasmid
#42503)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5077
- Total vector size (bp) 7261
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesoluble PACE
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2145
-
GenBank IDNM_002569
-
Entrez GeneFURIN (a.k.a. FUR, PACE, PCSK3, SPC1)
- Promoter cmv
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gctctctggctaactagagaa
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSYN-PACE-001 was a gift from Robert Peters (Addgene plasmid # 42503 ; http://n2t.net/addgene:42503 ; RRID:Addgene_42503) -
For your References section:
Biochemical and functional characterization of a recombinant monomeric Factor VIII-Fc fusion protein. Peters RT, Toby G, Lu Q, Liu T, Kulman JD, Low SC, Bitonti AJ, Pierce GF. J Thromb Haemost. 2012 Dec 4. doi: 10.1111/jth.12076. 10.1111/jth.12076 PubMed 23205847