Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pChuA
(Plasmid #42539)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSFDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3418
  • Total vector size (bp) 5472
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChuA
  • Alt name
    O157:H7 ChuA
  • Species
    E. coli O157:H7
  • Insert Size (bp)
    1983
  • Entrez Gene
    chuA (a.k.a. Z4911)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pChuA was a gift from Alan Jasanoff (Addgene plasmid # 42539 ; http://n2t.net/addgene:42539 ; RRID:Addgene_42539)
  • For your References section:

    Metal-substituted protein MRI contrast agents engineered for enhanced relaxivity and ligand sensitivity. Lelyveld VS, Brustad E, Arnold FH, Jasanoff A. J Am Chem Soc. 2011 Feb 2;133(4):649-51. doi: 10.1021/ja107936d. 10.1021/ja107936d PubMed 21171606