-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSFDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3418
- Total vector size (bp) 5472
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChuA
-
Alt nameO157:H7 ChuA
-
SpeciesE. coli O157:H7
-
Insert Size (bp)1983
-
Entrez GenechuA (a.k.a. Z4911)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pChuA was a gift from Alan Jasanoff (Addgene plasmid # 42539 ; http://n2t.net/addgene:42539 ; RRID:Addgene_42539) -
For your References section:
Metal-substituted protein MRI contrast agents engineered for enhanced relaxivity and ligand sensitivity. Lelyveld VS, Brustad E, Arnold FH, Jasanoff A. J Am Chem Soc. 2011 Feb 2;133(4):649-51. doi: 10.1021/ja107936d. 10.1021/ja107936d PubMed 21171606