Skip to main content

shYAP1 # 1
(Plasmid #42540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42540 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    TRC
  • Backbone size w/o insert (bp) 8000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP1
  • gRNA/shRNA sequence
    GCCACCAAGCTAGATAAAGAA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001130145
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (destroyed during cloning)
  • 3′ cloning site EcoR1 (destroyed during cloning)
  • 5′ sequencing primer pLKOF
  • 3′ sequencing primer pLKOR
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Broad RNAi consortium (TRC)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shYAP1 # 1 was a gift from William Hahn (Addgene plasmid # 42540 ; http://n2t.net/addgene:42540 ; RRID:Addgene_42540)
  • For your References section:

    beta-Catenin-Driven Cancers Require a YAP1 Transcriptional Complex for Survival and Tumorigenesis. Rosenbluh J, Nijhawan D, Cox AG, Li X, Neal JT, Schafer EJ, Zack TI, Wang X, Tsherniak A, Schinzel AC, Shao DD, Schumacher SE, Weir BA, Vazquez F, Cowley GS, Root DE, Mesirov JP, Beroukhim R, Kuo CJ, Goessling W, Hahn WC. Cell. 2012 Dec 21;151(7):1457-73. doi: 10.1016/j.cell.2012.11.026. Epub 2012 Dec 13. 10.1016/j.cell.2012.11.026 PubMed 23245941