-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRL-cPPT-X-PRE-SIN
-
Backbone manufacturerWilliam Osborne
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name6 x HIF binding element
-
SpeciesSynthetic
-
Insert Size (bp)315
-
Tag
/ Fusion Protein
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HIF reporter construct was generated with HIF1α consensus binding site CGTG followed HIF2α site TACGTG together as one unit of binding site for HIFα factors and repeated them in tandem 6 times (HBR-6U), with 5 base pairs of nucleotides of various combinations spacing between. Induction element CACAG, a DNA element necessary for hypoxic induction, was evenly inserted into the whole sequences three times to assist in the induction process.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HBR-6U was a gift from Hannele RuoholaBaker (Addgene plasmid # 42621 ; http://n2t.net/addgene:42621 ; RRID:Addgene_42621) -
For your References section:
Assessment of hypoxia inducible factor levels in cancer cell lines upon hypoxic induction using a novel reporter construct. Zhou W, Dosey TL, Biechele T, Moon RT, Horwitz MS, Ruohola-Baker H. PLoS One. 2011;6(11):e27460. doi: 10.1371/journal.pone.0027460. Epub 2011 Nov 23. 10.1371/journal.pone.0027460 PubMed 22132102