pCAG-LplA(AILR,36)-NRX3b
(Plasmid
#43919)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4247
- Total vector size (bp) 6647
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAILR-LplA36-NRX3b
-
Alt nameNeurexin3b
-
Alt nameLplA
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GenelplA (a.k.a. b4386, ECK4378, slr, yjjF)
- Promoter Chicken beta actin
-
Tag
/ Fusion Protein
- 2XHA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGCCGCCGTCCCCTTCTCCATCTC
- 3′ sequencing primer CAGGCTTTACACTTTATGCTTCCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-LplA(AILR,36)-NRX3b was a gift from Alice Ting (Addgene plasmid # 43919 ; http://n2t.net/addgene:43919 ; RRID:Addgene_43919) -
For your References section:
Imaging trans-cellular neurexin-neuroligin interactions by enzymatic probe ligation. Liu DS, Loh KH, Lam SS, White KA, Ting AY. PLoS One. 2013;8(2):e52823. doi: 10.1371/journal.pone.0052823. Epub 2013 Feb 14. 10.1371/journal.pone.0052823 PubMed 23457442