Skip to main content

pXL-CAG-mBirA272-NRX3b
(Plasmid #43921)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 43921 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXL-CAG
  • Backbone size w/o insert (bp) 6299
  • Total vector size (bp) 8624
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BirA272-NRX3b
  • Alt name
    Neurexin3b
  • Alt name
    BirA
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2772
  • Mutation
    See comments
  • Entrez Gene
    birA (a.k.a. ECs_4900)
  • Promoter CAG
  • Tag / Fusion Protein
    • 2XFLAG

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACCCCCTCTAGCGGGCGCGG
  • 3′ sequencing primer TGTGAGCCAGGGCATTGGCCACACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

272 indicates the amino acid position that the BirA is inserted in for NRX3b. There is a single alanine deletion in BirA, which is a non-dimerizing mutation. The BirA and AILR insert regions of the plasmid is codon optimized.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXL-CAG-mBirA272-NRX3b was a gift from Alice Ting (Addgene plasmid # 43921 ; http://n2t.net/addgene:43921 ; RRID:Addgene_43921)
  • For your References section:

    Imaging trans-cellular neurexin-neuroligin interactions by enzymatic probe ligation. Liu DS, Loh KH, Lam SS, White KA, Ting AY. PLoS One. 2013;8(2):e52823. doi: 10.1371/journal.pone.0052823. Epub 2013 Feb 14. 10.1371/journal.pone.0052823 PubMed 23457442