Skip to main content

pCAGGS-I-SceI-Trex2
(Plasmid #44024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44024 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    I-SceI fused to mTREX2
  • GenBank ID
    NM_001184371 NM_011907
  • Promoter pCAGGS
  • Tag / Fusion Protein
    • NLS-HA (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcctacagctcctgggcaacg
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mammalian expression vector for I-SceI-Trex2 fusion protein to generate site-specific non-cohesive chromosomal breaks. I-SceI generates a double strand break within its 18 base pair recognition site, leaving 4 nucleotide ssDNA overhangs. Trex2 is a non-processive 3' exonuclease that can degrade the I-SceI 3' overhang. Subsequent end joining repair causes efficient loss of chromosomal I-SceI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-I-SceI-Trex2 was a gift from Jeremy Stark (Addgene plasmid # 44024 ; http://n2t.net/addgene:44024 ; RRID:Addgene_44024)
  • For your References section:

    Correct end use during end joining of multiple chromosomal double strand breaks is influenced by repair protein RAD50, DNA-dependent protein kinase DNA-PKcs, and transcription context. Gunn A, Bennardo N, Cheng A, Stark JM. J Biol Chem. 2011 Dec 9;286(49):42470-82. doi: 10.1074/jbc.M111.309252. Epub 2011 Oct 24. 10.1074/jbc.M111.309252 PubMed 22027841