Skip to main content

K15/LacZ
(Plasmid #44265)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44265 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMVbeta
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7164
  • Total vector size (bp) 12152
  • Modifications to backbone
    CMV promoter replaced with murine K15 promoter (-4.8) fragment
  • Vector type
    Mammalian Expression, Mouse Targeting ; β-Galactosidase
  • Selectable markers
    LacZ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    K15 promoter (-4.8)
  • Alt name
    Krt1-15 promoter
  • Alt name
    mouse keratin 15 promoter
  • Alt name
    Krt15 keratin 15
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4961
  • Mutation
    Contains the murine K15 promoter (-4.8) fragment
  • GenBank ID
    NC_000077.6 AF542050
  • Entrez Gene
    Krt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
  • Promoter murine K15 promoter (-4.8) fragment
  • Tag / Fusion Protein
    • LacZ (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer Amp-R
  • 3′ sequencing primer LacZ-R; EBV-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: K15-LacZ-pCMVβ

The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were

CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),

respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pCMVβ (Clontech).

The entire K15 promoter-lacZ transgene can be released by digestion with XhoI/SalI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K15/LacZ was a gift from George Cotsarelis (Addgene plasmid # 44265 ; http://n2t.net/addgene:44265 ; RRID:Addgene_44265)
  • For your References section:

    Keratin 15 promoter targets putative epithelial stem cells in the hair follicle bulge. Liu Y, Lyle S, Yang Z, Cotsarelis G. J Invest Dermatol. 2003 Nov;121(5):963-8. 10.1046/j.1523-1747.2003.12600.x PubMed 14708593