K15/LacZ
(Plasmid
#44265)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMVbeta
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7164
- Total vector size (bp) 12152
-
Modifications to backboneCMV promoter replaced with murine K15 promoter (-4.8) fragment
-
Vector typeMammalian Expression, Mouse Targeting ; β-Galactosidase
-
Selectable markersLacZ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameK15 promoter (-4.8)
-
Alt nameKrt1-15 promoter
-
Alt namemouse keratin 15 promoter
-
Alt nameKrt15 keratin 15
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4961
-
MutationContains the murine K15 promoter (-4.8) fragment
-
GenBank IDNC_000077.6 AF542050
-
Entrez GeneKrt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
- Promoter murine K15 promoter (-4.8) fragment
-
Tag
/ Fusion Protein
- LacZ (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer Amp-R
- 3′ sequencing primer LacZ-R; EBV-rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternate plasmid name: K15-LacZ-pCMVβ
The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were
CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),
respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pCMVβ (Clontech).
The entire K15 promoter-lacZ transgene can be released by digestion with XhoI/SalI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K15/LacZ was a gift from George Cotsarelis (Addgene plasmid # 44265 ; http://n2t.net/addgene:44265 ; RRID:Addgene_44265) -
For your References section:
Keratin 15 promoter targets putative epithelial stem cells in the hair follicle bulge. Liu Y, Lyle S, Yang Z, Cotsarelis G. J Invest Dermatol. 2003 Nov;121(5):963-8. 10.1046/j.1523-1747.2003.12600.x PubMed 14708593
Map uploaded by the depositor.

Map uploaded by the depositor.
