pCIG-Flag-Sox9-IRES-nls-GFP
(Plasmid
#44281)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCIG
-
Backbone manufacturerSean Megason and Andrew McMahon
- Backbone size w/o insert (bp) 6240
- Total vector size (bp) 7740
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlag-Sox9
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)1500
-
GenBank IDAB012236.1
-
Entrez GeneSOX9 (a.k.a. SOX-9)
- Promoter CMV-IE enhancer and Chicken beta-actin promoter
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer tacagctcctgggcaacgtg
- 3′ sequencing primer gcttcggccagtaacgttag
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIG-Flag-Sox9-IRES-nls-GFP was a gift from Martin Cheung (Addgene plasmid # 44281 ; http://n2t.net/addgene:44281 ; RRID:Addgene_44281) -
For your References section:
Phosphorylation of Sox9 is required for neural crest delamination and is regulated downstream of BMP and canonical Wnt signaling. Liu JA, Wu MH, Yan CH, Chau BK, So H, Ng A, Chan A, Cheah KS, Briscoe J, Cheung M. Proc Natl Acad Sci U S A. 2013 Feb 19;110(8):2882-7. doi: 10.1073/pnas.1211747110. Epub 2013 Feb 4. 10.1073/pnas.1211747110 PubMed 23382206