pSoup 0800 (35S::REN)
(Plasmid
#44469)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSoup
- Backbone size w/o insert (bp) 9275
- Total vector size (bp) 11674
-
Vector typePlant Transformation
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow for 48hrs.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameA Renilla-derived luciferase gene
-
Alt nameREN
-
Insert Size (bp)2399
- Promoter 35S Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer RAJ-198 (CTTAGTTTACCCGCCAATATATCCTGTCA)
- 3′ sequencing primer RAJ-199 (AGATCTTGGCAGGATATATTGTGGTGTAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference: Johnson RA, Hellens RP, Love DR (2011) A transient assay for recombination demonstrates that Arabidopsis SNM1 and XRCC3 enhance non-homologous recombination. Genetics and Molecular Research 10 (3):2104-2132. doi:10.4238/vol10-3gmr1347
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSoup 0800 (35S::REN) was a gift from Roger Hellens (Addgene plasmid # 44469)