Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-shBRCA1 #2
(Plasmid #44595)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44595 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone manufacturer
    Robert Weinberg (Addgene plasmid #8453)
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRCA1
  • gRNA/shRNA sequence
    AAACATGTCAGGAGCAGCAAT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Brca1
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Observed knockdown = 85%

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-shBRCA1 #2 was a gift from Eros Lazzerini Denchi (Addgene plasmid # 44595 ; http://n2t.net/addgene:44595 ; RRID:Addgene_44595)
  • For your References section:

    A two-step mechanism for TRF2-mediated chromosome-end protection. Okamoto K, Bartocci C, Ouzounov I, Diedrich JK, Yates Iii JR, Denchi EL. Nature. 2013 Feb 6. doi: 10.1038/nature11873. 10.1038/nature11873 PubMed 23389450