Skip to main content

pTK023
(Plasmid #44860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44860 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTK021
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ADH4-PURA3-URA3-G8-yEGFP1-CLN2PD-NLSSV40-TURA3-TG
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer AAAAATCGAACGAACTCATAAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK023 was a gift from Michael Grunstein (Addgene plasmid # 44860 ; http://n2t.net/addgene:44860 ; RRID:Addgene_44860)
  • For your References section:

    Mechanism for epigenetic variegation of gene expression at yeast telomeric heterochromatin. Kitada T, Kuryan BG, Tran NN, Song C, Xue Y, Carey M, Grunstein M. Genes Dev. 2012 Nov 1;26(21):2443-55. doi: 10.1101/gad.201095.112. 10.1101/gad.201095.112 PubMed 23124068