Skip to main content

pTPGI_dCas9_VP64
(Plasmid #49013)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49013 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTPGI (pRS304)
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9_VP64 (codon-optimized for expression in S. cerevisiae)
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4335
  • Promoter pTPGI (galactose+aTc inducible)
  • Tag / Fusion Protein
    • SV40 NLS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCCTCGCGCCGCACTGCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTPGI_dCas9_VP64 was a gift from Timothy Lu (Addgene plasmid # 49013 ; http://n2t.net/addgene:49013 ; RRID:Addgene_49013)
  • For your References section:

    Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949