-
Depositing Lab
-
Sequence Information
-
Sequences (6) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCHA
- Backbone size w/o insert (bp) 6096
- Total vector size (bp) 6873
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVRC01 scFv
-
Insert Size (bp)777
- Promoter GAL1
-
Tags
/ Fusion Proteins
- HA (N terminal on backbone)
- Myc (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTGGGGTAATTAATCAGCGAAGCG
- 3′ sequencing primer CATGGGAAAACATGTTGTTTACGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCHA-VRC01-scFv was a gift from Dane Wittrup (Addgene plasmid # 44874 ; http://n2t.net/addgene:44874 ; RRID:Addgene_44874) -
For your References section:
Rapid conformational epitope mapping of anti-gp120 antibodies with a designed mutant panel displayed on yeast. Mata-Fink J, Kriegsman B, Yu HX, Zhu H, Hanson MC, Irvine DJ, Wittrup KD. J Mol Biol. 2013 Jan 23;425(2):444-56. doi: 10.1016/j.jmb.2012.11.010. Epub 2012 Nov 15. 10.1016/j.jmb.2012.11.010 PubMed 23159556