pZHY051
(Plasmid
#44987)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonevarious
-
Vector typePlant Expression
- Promoter 35S
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACGTAAGGGATGACGCACA
- 3′ sequencing primer aaattcgagctccaccgcggtgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there are a few small discrepancies between Addgene's quality control sequence and the depositor's full sequence. These differences do not affect any functional elements.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZHY051 was a gift from Daniel Voytas (Addgene plasmid # 44987 ; http://n2t.net/addgene:44987 ; RRID:Addgene_44987) -
For your References section:
TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327