Skip to main content

pZHY051
(Plasmid #44987)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44987 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    various
  • Vector type
    Plant Expression
  • Promoter 35S

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACGTAAGGGATGACGCACA
  • 3′ sequencing primer aaattcgagctccaccgcggtgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there are a few small discrepancies between Addgene's quality control sequence and the depositor's full sequence. These differences do not affect any functional elements.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY051 was a gift from Daniel Voytas (Addgene plasmid # 44987 ; http://n2t.net/addgene:44987 ; RRID:Addgene_44987)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327