Skip to main content

pZHY402
(Plasmid #45044)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45044 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Total vector size (bp) 5007
  • Vector type
    Reporter; plant expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN T30 Target Sequence
  • Species
    N. tobaccum
  • Insert Size (bp)
    62
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GGCAAGCTGACCCTGAAGTTC
  • 3′ sequencing primer GAACTTCAAGATCCGCCACAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY402 was a gift from Daniel Voytas (Addgene plasmid # 45044 ; http://n2t.net/addgene:45044 ; RRID:Addgene_45044)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327