Skip to main content

pRSV-CaMKIV
(Plasmid #45062)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45062 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSV-link
  • Backbone manufacturer
    Maurer lab
  • Backbone size w/o insert (bp) 4265
  • Total vector size (bp) 5675
  • Modifications to backbone
    Backbone derived from pRSV-globin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cam Kinase IV
  • Alt name
    camk4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1410
  • Mutation
    *
  • GenBank ID
    NM_009793.3
  • Entrez Gene
    Camk4 (a.k.a. A430110E23Rik, AI666733, CaM, CaMKI, CaMKIV, CaMKIV/Gr, D18Bwg0362e)
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGATACAATAAACGCCATTTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*This CaMKIV has a R128A mutation. The depositor considers this a polymorphism that is not functionally relevant.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSV-CaMKIV was a gift from Richard Maurer (Addgene plasmid # 45062 ; http://n2t.net/addgene:45062 ; RRID:Addgene_45062)
  • For your References section:

    Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915