Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRSV-CaMKII(1-290)
(Plasmid #45065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45065 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSV-link
  • Backbone manufacturer
    Maurer lab
  • Backbone size w/o insert (bp) 4265
  • Total vector size (bp) 5729
  • Modifications to backbone
    Backbone derived from pRSV-globin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CaM Kinase II
  • Alt name
    camk2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    892
  • Mutation
    truncated at amino acid 290
  • GenBank ID
    NM_012920.1
  • Entrez Gene
    Camk2a (a.k.a. PK2CDD, PKCCD)
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site Bgl II (destroyed during cloning)
  • 5′ sequencing primer CGATACAATAAACGCCATTTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSV-CaMKII(1-290) was a gift from Richard Maurer (Addgene plasmid # 45065 ; http://n2t.net/addgene:45065 ; RRID:Addgene_45065)
  • For your References section:

    Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915