Skip to main content

pRSV-PKI-v2
(Plasmid #45066)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45066 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSV-link
  • Backbone manufacturer
    Maurer lab
  • Backbone size w/o insert (bp) 4265
  • Total vector size (bp) 4517
  • Modifications to backbone
    Backbone derived from pRSV-globin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cAMP-dependent protein kinase inhibitor alpha
  • Alt name
    PKI alpha
  • Species
    Synthetic
  • Insert Size (bp)
    250
  • GenBank ID
    M23079.1
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGATACAATAAACGCCATTTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from RSV-PKI constructed by the Maurer lab and described in Day et al., J. Biol. Chem. 264, 431-436, 1989. Altered to add a Kozak consensus translation initiation sequence and also the ori was changed to yield high copy number in E coli.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSV-PKI-v2 was a gift from Richard Maurer (Addgene plasmid # 45066 ; http://n2t.net/addgene:45066 ; RRID:Addgene_45066)