Skip to main content
Addgene

pFS16 Pmyo-3 NPP-9 mChBioFLAG
(Plasmid #45099)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45099 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEM-T Easy
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2891
  • Total vector size (bp) 15665
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    npp-9
  • Species
    C. elegans (nematode)
  • Entrez Gene
    npp-9 (a.k.a. CELE_F59A2.1)
  • Promoter myo-3
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • BLRP (C terminal on insert)
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (not destroyed)
  • 3′ cloning site SbfI (destroyed during cloning)
  • 5′ sequencing primer ATATTGGAGGAGAGCCTACC
  • 3′ sequencing primer CCTTGAAGCGCATGAACTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    unc-119
  • Species
    C. elegans (nematode)
  • Entrez Gene
    unc-119 (a.k.a. CELE_M142.1)
  • Promoter unc-119

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GTAATACGACTCACTATAGG
  • 3′ sequencing primer CGGCAGTGATAGAGTACAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFS16 Pmyo-3 NPP-9 mChBioFLAG was a gift from Steven Henikoff (Addgene plasmid # 45099 ; http://n2t.net/addgene:45099 ; RRID:Addgene_45099)
  • For your References section:

    Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Steiner FA, Talbert PB, Kasinathan S, Deal RB, Henikoff S. Genome Res. 2012 Apr;22(4):766-77. doi: 10.1101/gr.131748.111. Epub 2012 Jan 4. 10.1101/gr.131748.111 PubMed 22219512