-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEM-T Easy
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2891
- Total vector size (bp) 15665
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namenpp-9
-
SpeciesC. elegans (nematode)
-
Entrez Genenpp-9 (a.k.a. CELE_F59A2.1)
- Promoter myo-3
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- BLRP (C terminal on insert)
- FLAG (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (not destroyed)
- 3′ cloning site SbfI (destroyed during cloning)
- 5′ sequencing primer ATATTGGAGGAGAGCCTACC
- 3′ sequencing primer CCTTGAAGCGCATGAACTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameunc-119
-
SpeciesC. elegans (nematode)
-
Entrez Geneunc-119 (a.k.a. CELE_M142.1)
- Promoter unc-119
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GTAATACGACTCACTATAGG
- 3′ sequencing primer CGGCAGTGATAGAGTACAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFS16 Pmyo-3 NPP-9 mChBioFLAG was a gift from Steven Henikoff (Addgene plasmid # 45099 ; http://n2t.net/addgene:45099 ; RRID:Addgene_45099) -
For your References section:
Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Steiner FA, Talbert PB, Kasinathan S, Deal RB, Henikoff S. Genome Res. 2012 Apr;22(4):766-77. doi: 10.1101/gr.131748.111. Epub 2012 Jan 4. 10.1101/gr.131748.111 PubMed 22219512