pFS16 Pmyo-3 NPP-9 mChBioFLAG
(Plasmid #45099)

• Depositing Lab: Steven Henikoff
• Publication: Steiner et al Genome Res. 2012 Apr;22(4):766-77. doi: 10.1101/gr.131748.111. Epub 2012 Jan 4.

Backbone

• Vector backbone: pGEM-T Easy
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2891
• Total vector size (bp): 15665
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: npp-9
• Species: C. elegans (nematode)
• Entrez Gene: npp-9 (a.k.a. CELE_F59A2.1)
• Promoter: myo-3
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • BLRP (C terminal on insert)
  • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (not destroyed)
• 3′ cloning site: SbfI (destroyed during cloning)
• 5′ sequencing primer: ATATTGGAGGAGAGCCTACC
• 3′ sequencing primer: CCTTGAAGCGCATGAACTCC

Gene/Insert 2

• Gene/Insert name: unc-119
• Species: C. elegans (nematode)
• Entrez Gene: unc-119 (a.k.a. CELE_M142.1)
• Promoter: unc-119

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: GTAATACGACTCACTATAGG
• 3′ sequencing primer: CGGCAGTGATAGAGTACAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry