pLenti-Arch-EEN
(Plasmid
#45189)
-
PurposeArch voltage indicator with double mutations D95N-D106E (Arch-EEN), with faster kinetics and greater fluorescence dynamic range than Arch-D95N
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9239
- Total vector size (bp) 10793
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced Archaerhodopsin-3
-
Alt nameArch-EEN
-
SpeciesH. sodomense
-
Insert Size (bp)1554
-
MutationD95N, D106E
- Promoter CamKIIa
-
Tag
/ Fusion Protein
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctgacgaaggctcgcgaggc
- 3′ sequencing primer gccatacgggaagcaatagcatg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDeisseroth lab: Plasmid 35514: pLenti-CaMKIIa-eArch 3.0-EYFP
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there may be several sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence which are consistant with the discrepancies in plasmid 35514. These changes are in vector regions only and should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Arch-EEN was a gift from Mark Schnitzer (Addgene plasmid # 45189 ; http://n2t.net/addgene:45189 ; RRID:Addgene_45189) -
For your References section:
Enhanced Archaerhodopsin Fluorescent Protein Voltage Indicators. Gong Y, Li JZ, Schnitzer MJ. PLoS One. 2013 Jun 19;8(6):e66959. 10.1371/journal.pone.0066959 PubMed 23840563