-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-CaMKIIa-eArch 3.0-EYFP (Addgene plasmid# 35514)
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 9239
- Total vector size (bp) 10793
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse Amp at 50ug/mL
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced Archaerhodopsin
-
Alt nameArch-EEQ
-
SpeciesSynthetic; H. sodomense
-
Insert Size (bp)1554
-
MutationD95Q, D106E (results in faster kinetics and greater fluorescence dynamic range than Arch-D95N)
- Promoter CamKIIa
-
Tag
/ Fusion Protein
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctgacgaaggctcgcgaggc
- 3′ sequencing primer gccatacgggaagcaatagcatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Arch-EEQ was a gift from Mark Schnitzer (Addgene plasmid # 45188 ; http://n2t.net/addgene:45188 ; RRID:Addgene_45188) -
For your References section:
Enhanced Archaerhodopsin Fluorescent Protein Voltage Indicators. Gong Y, Li JZ, Schnitzer MJ. PLoS One. 2013 Jun 19;8(6):e66959. Print 2013. PubMed 23840563