Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-Arch-EEQ
(Plasmid #45188)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45188 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti-CaMKIIa-eArch 3.0-EYFP (Addgene plasmid# 35514)
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 9239
  • Total vector size (bp) 10793
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use Amp at 50ug/mL
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    enhanced Archaerhodopsin
  • Alt name
    Arch-EEQ
  • Species
    Synthetic; H. sodomense
  • Insert Size (bp)
    1554
  • Mutation
    D95Q, D106E (results in faster kinetics and greater fluorescence dynamic range than Arch-D95N)
  • Promoter CamKIIa
  • Tag / Fusion Protein
    • eYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctgacgaaggctcgcgaggc
  • 3′ sequencing primer gccatacgggaagcaatagcatg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Arch-EEQ was a gift from Mark Schnitzer (Addgene plasmid # 45188 ; http://n2t.net/addgene:45188 ; RRID:Addgene_45188)
  • For your References section:

    Enhanced Archaerhodopsin Fluorescent Protein Voltage Indicators. Gong Y, Li JZ, Schnitzer MJ. PLoS One. 2013 Jun 19;8(6):e66959. Print 2013. PubMed 23840563