Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AmCyan-P2A-mCherry
(Plasmid #45350)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45350 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmR-mCherry
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4729
  • Total vector size (bp) 5607
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AmCyan
  • Alt name
    AmCyan1 fluorescent protein
  • Alt name
    nAmCyan nuclear localization
  • Species
    Synthetic
  • Insert Size (bp)
    890
  • Mutation
    SV40 NLS
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer GGTACCGTCGACTGCAGAAT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

the nAmCyan and the mCherry genes are separated by a P2A sequence that results in 2 separate proteins. It also includes BsmBI restriction sites flanking the nAmCyan gene which result in BsiWI and BssHII overhangs for cloning in-frame with P2A-mCherry.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AmCyan-P2A-mCherry was a gift from Ilpo Huhtaniemi (Addgene plasmid # 45350 ; http://n2t.net/addgene:45350 ; RRID:Addgene_45350)
  • For your References section:

    A vital region for human glycoprotein hormone trafficking revealed by an LHB mutation. Potorac I, Rivero-Muller A, Trehan A, Kielbus M, Jozwiak K, Pralong F, Hafidi A, Thiry A, Menage JJ, Huhtaniemi IT, Beckers A, Daly AF. J Endocrinol. 2016 Sep 21. pii: JOE-16-0384. 10.1530/JOE-16-0384 PubMed 27656125