Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pC5Kan-P2A
(Plasmid #51814)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51814 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pC5-Kan_delta_SphI
  • Backbone manufacturer
    EF090405
  • Backbone size w/o insert (bp) 2619
  • Total vector size (bp) 2685
  • Modifications to backbone
    P2A peptide coding sequence inserted in middle of MCS of pC5-Kan shuttle vector for easy transfer into C5-series Drosophila expression vectors.
  • Vector type
    shuttle vector for insect expression vectors

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P2A peptide
  • Alt name
    2A peptide from porcine teschovirus-1
  • Species
    Synthetic; porcine teschovirus-1
  • Insert Size (bp)
    66
  • Mutation
    codons altered for Drosophila and to eliminate restriction sites
  • GenBank ID
    NP_740353
  • Entrez Gene
    PTV1gp1 (a.k.a. PTV1gp1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer AAGCAGCAGATTACGCGCAG
  • 3′ sequencing primer GCCATCACGAGATTTCGATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Useful for cloning two proteins for bicistronic expression. Proteins undergo an efficient co-translational separation event due to the presence of the 2A peptide sequence derived from porcine teschovirus-1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC5Kan-P2A was a gift from Barry Ganetzky (Addgene plasmid # 51814 ; http://n2t.net/addgene:51814 ; RRID:Addgene_51814)
  • For your References section:

    Expression of multiple transgenes from a single construct using viral 2A peptides in Drosophila. Daniels RW, Rossano AJ, Macleod GT, Ganetzky B. PLoS One. 2014 Jun 19;9(6):e100637. doi: 10.1371/journal.pone.0100637. eCollection 2014. 10.1371/journal.pone.0100637 PubMed 24945148