pNK-TGCK
(Plasmid
#45359)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4200
- Total vector size (bp) 10855
-
Modifications to backboneMouse 2.5 kb Nkx cardiac enhancer and promoter fragment present upstream of tTA. Cre recombinase present (fused) downstream of EGFP, driven by a minimal TetO-CMV promoter
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nametTA
-
Alt nametetracycline-responsive activator
-
Insert Size (bp)850
- Promoter Mouse Nkx2.5 cardiac enhancer and promoter fragment
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer Unknown
- 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP-Cre
-
Alt nameEGFP
-
Alt nameCre recombinase
-
Insert Size (bp)1800
- Promoter minimal TetO-CMV promoter
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made by2.1 kb murine Nkx2.5 enhancer fragment from Dr. Eric Olson, UT Southwestern, Dallas, TX, by MTA with Children's Hospital, Boston, MA. A portion of the plasmid derived from DNA provided by Andrew McMahon, Harvard University.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternate plasmid name: Nkx2.5 cardiac enhancer-tTA-TetO-CMV min-Cre-eGFP (TGCK)
Plasmid full sequence is approximated and may not be entirely accurate.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNK-TGCK was a gift from Sean Wu (Addgene plasmid # 45359 ; http://n2t.net/addgene:45359 ; RRID:Addgene_45359)