Skip to main content

pNK-TGCK
(Plasmid #45359)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45359 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 10855
  • Modifications to backbone
    Mouse 2.5 kb Nkx cardiac enhancer and promoter fragment present upstream of tTA. Cre recombinase present (fused) downstream of EGFP, driven by a minimal TetO-CMV promoter
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    tTA
  • Alt name
    tetracycline-responsive activator
  • Insert Size (bp)
    850
  • Promoter Mouse Nkx2.5 cardiac enhancer and promoter fragment

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eGFP-Cre
  • Alt name
    EGFP
  • Alt name
    Cre recombinase
  • Insert Size (bp)
    1800
  • Promoter minimal TetO-CMV promoter

Cloning Information for Gene/Insert 2

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    2.1 kb murine Nkx2.5 enhancer fragment from Dr. Eric Olson, UT Southwestern, Dallas, TX, by MTA with Children's Hospital, Boston, MA. A portion of the plasmid derived from DNA provided by Andrew McMahon, Harvard University.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: Nkx2.5 cardiac enhancer-tTA-TetO-CMV min-Cre-eGFP (TGCK)

Plasmid full sequence is approximated and may not be entirely accurate.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK-TGCK was a gift from Sean Wu (Addgene plasmid # 45359 ; http://n2t.net/addgene:45359 ; RRID:Addgene_45359)