Skip to main content

pR6Kcat-rdxA-rpsL
(Plasmid #45471)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45471 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pR6K
  • Total vector size (bp) 2730
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    HB101 lambda pir
  • Growth instructions
    Pick the smaller colonies.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cat-rdxA-rpsL
  • Alt name
    MB 776

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer R6K-3'
  • 3′ sequencing primer ttaagccttaggacgcttcacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Full cassette consists of: NotI-SpeI-SexAI-EcoRI-cat-rdxA-rpsL-EcoRI-NotI-ClaI-BamHI-NotI.

Cassette gives slightly smaller slower growing colonies--use the small ones for the strongest counter-selection as big ones may have accumulated point mutations. For counter selection, use fresh plates.

This construct is sensitive to metronidazole and streptomycin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR6Kcat-rdxA-rpsL was a gift from Michele Swanson (Addgene plasmid # 45471 ; http://n2t.net/addgene:45471 ; RRID:Addgene_45471)
  • For your References section:

    Oligonucleotides stimulate genomic alterations of Legionella pneumophila. Bryan A, Swanson MS. Mol Microbiol. 2011 Apr;80(1):231-47. doi: 10.1111/j.1365-2958.2011.07573.x. Epub 2011 Feb 24. 10.1111/j.1365-2958.2011.07573.x PubMed 21306445