pCVL.SSA TLR (Ani)
(Plasmid
#45577)
-
PurposeCodes for the SSA-TLR with the target site for I-Ani I in a lentiviral backbone
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCVL
- Backbone size w/o insert (bp) 5069
- Total vector size (bp) 10434
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name5' iRFP arm
-
Insert Size (bp)837
-
Mutationtruncated 38 amino acids from C terminus
- Promoter SFFV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer SFFVpro-F (CTTCTGCTTCCCGAGCTCTA)
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP with I-Ani I TS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)759
-
Mutationembedded I-Ani I TS from 163-185bp
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Unknown
- 3′ sequencing primer mCherry-R
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert name+3 mCherry
-
Insert Size (bp)708
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer EGFP-C
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert name3' iRFP arm
-
Insert Size (bp)876
-
Mutationtruncated 25 amino acids on the N terminus
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer mCherry-F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCVL.SSA TLR (Ani) was a gift from Andrew Scharenberg (Addgene plasmid # 45577 ; http://n2t.net/addgene:45577 ; RRID:Addgene_45577) -
For your References section:
Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks. Kuhar R, Gwiazda KS, Humbert O, Mandt T, Pangallo J, Brault M, Khan I, Maizels N, Rawlings DJ, Scharenberg AM, Certo MT. Nucleic Acids Res. 2013 Oct 10. 10.1093/nar/gkt872 PubMed 24121685