pQuantA-hygro-amp
(Plasmid
#45584)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSilencer 2.1-U6 hygro
-
Backbone manufacturerAmbion
-
Vector typeCre/Lox ; DT40 cell line targeting
-
Selectable markersHygromycin
-
Tag
/ Fusion Protein
- Quant-A tag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGGACTTTCCACACCTGG
- 3′ sequencing primer GGGTTTTGTTTCATCACAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQuantA-hygro-amp was a gift from Andrzej Dziembowski (Addgene plasmid # 45584 ; http://n2t.net/addgene:45584 ; RRID:Addgene_45584) -
For your References section:
A new strategy for gene targeting and functional proteomics using the DT40 cell line. Orlowska KP, Klosowska K, Szczesny RJ, Cysewski D, Krawczyk PS, Dziembowski A. Nucleic Acids Res. 2013 Sep;41(17):e167. doi: 10.1093/nar/gkt650. Epub 2013 Jul 27. 10.1093/nar/gkt650 PubMed 23892402
Map uploaded by the depositor.
